Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)
X-RAY DIFFRACTION
Crystallization
| Crystalization Experiments | ||||
|---|---|---|---|---|
| ID | Method | pH | Temperature | Details |
| 1 | VAPOR DIFFUSION, HANGING DROP | 8.5 | 277 | 0.2 M Sodium citrate, 0.1 M TRIS-HCl pH 8.5, 36% PEG 400 |
| Crystal Properties | |
|---|---|
| Matthews coefficient | Solvent content |
| 4.02 | 69.41 |
Crystal Data
| Unit Cell | |
|---|---|
| Length ( Å ) | Angle ( ˚ ) |
| a = 43.19 | α = 90 |
| b = 94.32 | β = 90 |
| c = 154.34 | γ = 90 |
| Symmetry | |
|---|---|
| Space Group | P 21 21 21 |
Diffraction
| Diffraction Experiment | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ID # | Crystal ID | Scattering Type | Data Collection Temperature | Detector | Detector Type | Details | Collection Date | Monochromator | Protocol | |||||
| 1 | 1 | x-ray | 100 | CCD | ADSC QUANTUM 315 | 2011-03-05 | M | SINGLE WAVELENGTH | ||||||
| Radiation Source | |||||
|---|---|---|---|---|---|
| ID # | Source | Type | Wavelength List | Synchrotron Site | Beamline |
| 1 | SYNCHROTRON | APS BEAMLINE 24-ID-C | 0.97949 | APS | 24-ID-C |
Data Collection
| Overall | |||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ID # | Resolution (High) | Resolution (Low) | Percent Possible (Observed) | R Merge I (Observed) | Rpim I (All) | CC (Half) | Net I Over Average Sigma (I) | Redundancy | Number Reflections (All) | Number Reflections (Observed) | Observed Criterion Sigma (F) | Observed Criterion Sigma (I) | B (Isotropic) From Wilson Plot | ||||||
| 1 | 2.78 | 80.48 | 94.3 | 0.071 | 0.035 | 0.998 | 13.8 | 5.1 | 15712 | 39.23 | |||||||||
| Highest Resolution Shell | |||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ID # | Resolution (High) | Resolution (Low) | Percent Possible (All) | Percent Possible (Observed) | R Merge I (Observed) | Rpim I (All) | CC (Half) | Mean I Over Sigma (Observed) | Redundancy | Number Unique Reflections (All) | |||||||||
| 1 | 2.78 | 2.93 | 99.9 | 0.719 | 0.349 | 0.862 | 2.6 | 5.3 | 2372 | ||||||||||
Refinement
| Statistics | |||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Diffraction ID | Structure Solution Method | Cross Validation method | Resolution (High) | Resolution (Low) | Cut-off Sigma (F) | Number Reflections (Observed) | Number Reflections (R-Free) | Percent Reflections (Observed) | R-Factor (Observed) | R-Work (Depositor) | R-Work (DCC) | R-Free (Depositor) | R-Free (DCC) | Mean Isotropic B | |||||
| X-RAY DIFFRACTION | MOLECULAR REPLACEMENT | FREE R-VALUE | 2.78 | 59.727 | 1.34 | 14420 | 711 | 86.77 | 0.2222 | 0.2199 | 0.2293 | 0.2667 | 0.2711 | 43.9852 | |||||
| Temperature Factor Modeling | ||||||
|---|---|---|---|---|---|---|
| Anisotropic B[1][1] | Anisotropic B[1][2] | Anisotropic B[1][3] | Anisotropic B[2][2] | Anisotropic B[2][3] | Anisotropic B[3][3] | |
| RMS Deviations | |
|---|---|
| Key | Refinement Restraint Deviation |
| f_dihedral_angle_d | 24.417 |
| f_angle_d | 0.804 |
| f_chiral_restr | 0.031 |
| f_bond_d | 0.005 |
| f_plane_restr | 0.004 |
| Non-Hydrogen Atoms Used in Refinement | |
|---|---|
| Non-Hydrogen Atoms | Number |
| Protein Atoms | 1505 |
| Nucleic Acid Atoms | 1101 |
| Solvent Atoms | 8 |
| Heterogen Atoms | |
Software
| Software | |
|---|---|
| Software Name | Purpose |
| Aimless | data scaling |
| PHASER | phasing |
| PHENIX | refinement |
| PDB_EXTRACT | data extraction |














